TGIF (TGIF1) (NM_001278684) Human Untagged Clone
CAT#: SC334968
TGIF1 (untagged) - Human TGFB-induced factor homeobox 1 (TGIF1), transcript variant 10
CNY 2,950.00
货期*
3周
规格
Product images
经常一起买 (4)
TGIF1 mouse monoclonal antibody, clone OTI1B12 (formerly 1B12)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HPE4; TGIF |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001278684, the custom clone sequence may differ by one or more nucleotides
ATGAAAGGCAAGAAAGGTATTGTTGCAGCATCTGGCAGTGAGACTGAGGATGAGGACAGCATGGACATTC CCTTGGACCTTTCTTCATCCGCTGGCTCAGGCAAGAGAAGGAGAAGGGGCAACCTACCCAAGGAGTCTGT GCAGATTCTTCGGGATTGGCTGTATGAGCACCGTTACAATGCCTATCCTTCAGAGCAAGAAAAAGCGTTG CTGTCCCAGCAAACACACCTGTCTACGCTACAGGTCTGTAACTGGTTCATCAACGCCCGCCGCAGGCTCC TCCCTGACATGCTGAGAAAGGATGGCAAAGATCCAAATCAGTTCACAATTTCCCGCCGTGGGGCCAAGAT TTCTGAAACGAGCTCTGTGGAGTCCGTGATGGGCATCAAAAACTTCATGCCAGCTCTAGAGGAGACCCCA TTTCATTCCTGTACAGCTGGGCCAAACCCAACCCTAGGGAGGCCACTGTCTCCTAAGCCGTCATCCCCGG GATCAGTTTTGGCTCGTCCATCAGTGATCTGCCATACCACTGTGACTGCATTGAAAGATGTCCCTTTCTC TCTCTGCCAGTCGGTCGGTGTGGGACAAAACACAGATATACAGCAGATAGCGGCCAAAAACTTCACAGAC ACCTCTCTCATGTACCCAGAGGACACTTGTAAATCTGGACCAAGTACGAATACACAGAGTGGTCTTTTCA ACACTCCTCCCCCTACTCCACCGGACCTCAACCAGGACTTCAGTGGATTTCAGCTTCTAGTGGATGTTGC ACTCAAACGGGCTGCAGAGATGGAGCTTCAGGCAAAACTTACAGCTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001278684 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001278684.1, NP_001265613.1 |
RefSeq Size | 1887 bp |
RefSeq ORF | 819 bp |
Locus ID | 7050 |
UniProt ID | Q15583 |
Protein Families | Druggable Genome, Stem cell - Pluripotency, Stem cell relevant signaling - TGFb/BMP signaling pathway, Transcription Factors |
Gene Summary | The protein encoded by this gene is a member of the three-amino acid loop extension (TALE) superclass of atypical homeodomains. TALE homeobox proteins are highly conserved transcription regulators. This particular homeodomain binds to a previously characterized retinoid X receptor responsive element from the cellular retinol-binding protein II promoter. In addition to its role in inhibiting 9-cis-retinoic acid-dependent RXR alpha transcription activation of the retinoic acid responsive element, the protein is an active transcriptional co-repressor of SMAD2 and may participate in the transmission of nuclear signals during development and in the adult. Mutations in this gene are associated with holoprosencephaly type 4, which is a structural anomaly of the brain. Alternative splicing has been observed at this locus and multiple splice variants encoding distinct isoforms are described. [provided by RefSeq, Jul 2013] Transcript Variant: This variant (10) includes two alternate 5' exons, which result in a different 5' UTR and 5' coding region, compared to variant 1. The resulting isoform (c) is shorter and has a distinct N-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...