Uroplakin Ia (UPK1A) (NM_001281443) Human Untagged Clone
CAT#: SC334974
UPK1A (untagged) - Human uroplakin 1A (UPK1A), transcript variant 2
CNY 2,950.00
货期*
3周
规格
Product images
经常一起买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | TSPAN21; UP1A; UPIA; UPKA |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001281443, the custom clone sequence may differ by one or more nucleotides
ATGGCGTCTGCGGCAGCAGCGGAGGCCGAGAAGGGATCTCCAGTTGTGGTGGGCCTGCTAGTTGTGGGCA ATATCATTATTCTGCTGTCAGGCCTGTCCCTGTTTGCTGAGACCATATGGGTGACAGCCGACCAGTACCG TGTATACCCACTGATGGGAGTCTCAGGCAAGGATGACGTCTTCGCTGGTGCCTGGATTGCCATCTTCTGC GGCTTCTCCTTCTTCATGGTAGCCAGTTTTGGTGTGGGTGCCGCACTCTGCCGCCGCCGGTCCATGGTCC TCACGTACCTGGTGCTCATGCTCATCGTCTACATCTTCGAGTGCGCCTCCTGCATCACGTCCTACACCCA CCGTGACTACATGGTGTCCAACCCATCCCTGATCACCAAGCAGATGCTGACCTTCTACAGCGCGGACACC GACCAGGGCCAGGAGCTGACCCGCCTCTGGGACCGCGTCATGATTGAGCAAGAATGCTGTGGCACATCTG GTCCCATGGACTGGGTGAACTTCACGTCAGCCTTCCGGGCGGCCACTCCGGAGGTGGTGTTCCCCTGGCC CCCACTGTGCTGTCGCCGGACGGGAAACTTCATCCCCCTCAACGAGGAGGGCTGCCGCCTGGGGCACATG GACTACCTGTTCACCAAGGCTGGAGTACAGTGGCACAATCTCAGCTCACTGCAGCGTCTGCCTCCCGGGT TCAAGGGATTCTCCCACCTCAGCTTCCAGAGCAGCTGGGATTACAGGGCTGCTTCGAACACATCGGCCAC GCCATCGACAGCTACACGTGGGGTATCTCGTGGTTTGGGTTTGCCATCCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001281443 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001281443.1, NP_001268372.1 |
RefSeq Size | 1382 bp |
RefSeq ORF | 822 bp |
Locus ID | 11045 |
UniProt ID | O00322 |
Protein Families | Transmembrane |
Gene Summary | The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is found in the asymmetrical unit membrane (AUM) where it can complex with other transmembrane 4 superfamily proteins. It may play a role in normal bladder epithelial physiology, possibly in regulating membrane permeability of superficial umbrella cells or in stabilizing the apical membrane through AUM/cytoskeletal interactions. The protein may also play a role in tumor suppression. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013] Transcript Variant: This variant (2) contains an alternate exon in the 3' coding region, which results in a frameshift and an early stop codon, compared to variant 1. The encoded isoform (2) is longer and has a distinct C-terminus, compared to isoform 1.`. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
其它Uroplakin Ia产品
Customer
Reviews
Loading...