SMARCA2 (NM_001289400) Human Untagged Clone
CAT#: SC335016
SMARCA2 (untagged) - Human SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 (SMARCA2), transcript variant 7
CNY 2,950.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BAF190; BIS; BRM; hBRM; hSNF2a; NCBRS; SNF2; SNF2L2; SNF2LA; Sth1p; SWI2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001289400, the custom clone sequence may differ by one or more nucleotides
ATGCTGATGAAGAGACTAGCAGCTCGCTGCTTTGCTGGCTTGTTAATTTTATCCCCACTAACTGTGATTT CTGATAGCCGGCCTGCTGATAGTGGTAAGGCCATCGAAGACGGCAATTTGGAGGAAATGGAAGAGGAAGT ACGGCTTAAGAAGCGAAAAAGACGAAGAAATGTGGATAAAGATCCTGCAAAAGAAGATGTGGAAAAAGCT AAGAAGAGAAGAGGCCGCCCTCCCGCTGAGAAACTGTCACCAAATCCCCCCAAACTGACAAAGCAGATGA ACGCTATCATCGATACTGTGATAAACTACAAAGATAGTTCAGGGCGACAGCTCAGTGAAGTCTTCATTCA GTTACCTTCAAGGAAAGAATTACCAGAATACTATGAATTAATTAGGAAGCCAGTGGATTTCAAAAAAATA AAGGAAAGGATTCGTAATCATAAGTACCGGAGCCTAGGCGACCTGGAGAAGGATGTCATGCTTCTCTGTC ACAACGCTCAGACGTTCAACCTGGAGGGATCCCAGATCTATGAAGACTCCATCGTCTTACAGTCAGTGTT TAAGAGTGCCCGGCAGAAAATTGCCAAAGAGGAAGAGAGTGAGGATGAAAGCAATGAAGAGGAGGAAGAG GAAGATGAAGAAGAGTCAGAGTCCGAGGCAAAATCAGTCAAGGTGAAAATTAAGCTCAATAAAAAAGATG ACAAAGGCCGGGACAAAGGGAAAGGCAAGAAAAGGCCAAATCGAGGAAAAGCCAAACCTGTAGTGAGCGA TTTTGACAGCGATGAGGAGCAGGATGAACGTGAACAGTCAGAAGGAAGTGGGACGGATGATGAGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001289400 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001289400.1, NP_001276329.1 |
RefSeq Size | 2254 bp |
RefSeq ORF | 837 bp |
Locus ID | 6595 |
Protein Families | Druggable Genome |
Gene Summary | The protein encoded by this gene is a member of the SWI/SNF family of proteins and is highly similar to the brahma protein of Drosophila. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. Alternatively spliced transcript variants encoding different isoforms have been found for this gene, which contains a trinucleotide repeat (CAG) length polymorphism. [provided by RefSeq, Jan 2014] Transcript Variant: This variant (7) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate downstream start codon, compared to variant 1. The encoded protein (isoform f) has a shorter and distinct N-terminus, compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC237122 | SMARCA2 (myc-DDK-tagged) - Human SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 (SMARCA2), transcript variant 7 |
CNY 3,990.00 |
|
RG237122 | SMARCA2 (tGFP-tagged) - Human SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 (SMARCA2), transcript variant 7 |
CNY 4,370.00 |
其它SMARCA2产品