TRMT1 (TRMU) (NM_001282783) Human Untagged Clone

CAT#: SC335043

TRMU (untagged) - Human tRNA 5-methylaminomethyl-2-thiouridylate methyltransferase (TRMU), transcript variant 5



  "NM_001282783" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TRMU mouse monoclonal antibody, clone OTI2A4 (formerly 2A4)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms LCAL3; MTO2; MTU1; TRMT; TRMT1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001282783, the custom clone sequence may differ by one or more nucleotides


ATGCCATTGCCACAGGTCACTATGCAAGAACTTCCCTGGAAGATGAAGAAGTCTTTGAGCAGAAGCACGT
TAAGAAGCCCGAAGGGCTTTTCAGAAATCGGTTTGAAGTTAGAAATGGTTTCCCAGGATGCCCTGAGGAG
AACCATCTTCCCTCTGGGGGGATTAACGAAAGAGTTTGTAAAGAAAATCGCTGCTGAGAATAGACTTCAT
CATGTGCTTCAGAAGAAAGAGAGCATGGGCATGTGTTTCATCGGGAAGAGGAATTTTGAACATTTCCTTC
TTCAGTATCTGCAGCCTCGACCTGGTCACTTTATTTCCATAGAAGACAATAAGGTTCTGGGAACACATAA
AGGTTGGTTCCTGTATACCTTGGGCCAGAGAGCAAACATAGGTGGCCTGAGAGAGCCCTGGTACGTGGTG
GAGAAGGACAGCGTCAAGGGTGACGTGTTTGTGGCCCCCCGGACAGACCACCCAGCCCTGTACAGGGACC
TGCTGAGGACCAGCCGCGTGCACTGGATTGCGGAGGAGCCTCCCGCAGCACTGGTCCGGGACAAGATGAT
GGAGTGCCACTTCCGATTCCGCCACCAGATGGCACTAGTGCCCTGTGTGCTGACCCTCAATCAAGATGGC
ACCGTGTGGGTGACAGCTGTGCAGGCTGTGCGTGCCCTTGCCACAGGACAGTTTGCTGTGTTCTACAAGG
GGGACGAGTGCCTGGGCAGCGGGAAGATCCTGCGGCTGGGGCCGTCTGCCTACACGCTCCAGAAGGGCCA
GCGCAGAGCTGGGATGGCCACTGAGAGCCCCAGTGACAGCCCAGAAGATGGTCCAGGCCTGAGTCCCTTG
CTCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001282783
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001282783.1, NP_001269712.1
RefSeq Size 1808 bp
RefSeq ORF 846 bp
Locus ID 55687
UniProt ID O75648
Gene Summary This nuclear gene encodes a mitochondrial tRNA-modifying enzyme. The encoded protein catalyzes the 2-thiolation of uridine on the wobble positions of tRNA(Lys), tRNA(Glu), and tRNA(Gln), resulting in the formation of 5-taurinomethyl-2-thiouridine moieties. Mutations in this gene may cause transient infantile liver failure. Polymorphisms in this gene may also influence the severity of deafness caused by mitochondrial 12S ribosomal RNA mutations. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Transcript Variant: This variant (5) contains multiple differences in the coding region, including initiation of translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (e) is shorter than isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...