PSMG1 (NM_001261824) Human Untagged Clone

CAT#: SC335058

PSMG1 (untagged) - Human proteasome (prosome, macropain) assembly chaperone 1 (PSMG1), transcript variant 3



  "NM_001261824" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Goat Anti-DSCR2 / PSMG1 Antibody
    • 100 ug

CNY 5,371.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C21LRP; DSCR2; LRPC21; PAC-1; PAC1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001261824, the custom clone sequence may differ by one or more nucleotides


ATGGCGGCCACGTTCTTCGGAGAGGTGGTGAAGGCGCCGTGCCGAGCTGGGACTGAGGACGAAGAGGAGG
AGGAGGAGGGGCGGAGGGAGACGCCCGAGGACAGGGAGGTGCGTCTGCAGCTGGCGCGGAAGAGGGAAGT
GCGGCTCCTTCGAAGACAAACAAAAACATCTTTGGAAGTTTCTTTGCTAGAAAAATATCCGTGCTCCAAG
TTTATAATTGCTATAGGAAATAATGCAGTAGCATTTCTGTCATCATTTGTTATGAATTCAGGAGTCTGGG
AGGAAGTTGGTTGTGCTAAACTCTGGAATGAATGGTGTAGAACAACAGACACTACACATCTGTCCTCCAC
AGAGGCTTTTTGTGTGTTTTATCATCTAAAATCCAATCCCTCGTGCAGTTGCTATGTTGCAGAAGATCAA
CAGTATCAGTGGCTGGAAAAGGTTTTTGGCTCTTGTCCAAGGAAGAACATGCAGATAACTATTCTCACAT
GTCGACATGTTACCGATTATAAAACCTCAGAATCCACCGGCAGCCTTCCTTCTCCTTTCCTGAGAGCCCT
AAAAACACAGAATTTCAAAGACTCGGCGTGTTGTCCATTGCTAGAACAACCGAATATAGTACACGACCTT
CCTGCAGCAGTTCTAAGCTACTGTCAAGTATGGAAAATCCCAGCAATTCTGTACTTGTGTTATACTGATG
TGATGAAATTAGACCTAATCACAGTGGAAGCTTTTAAGCCTATACTTTCTACCAGAAGCTTGAAGGGTTT
GGTTAAGAATATTCCCCAAAGCACTGAGATACTAAAGAAATTGATGACAACAAATGAGATTCAGAGTAAC
ATTTATACATGA


Restriction Sites SgfI-MluI     
ACCN NM_001261824
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001261824.1, NP_001248753.1
RefSeq Size 1125 bp
RefSeq ORF 852 bp
Locus ID 8624
Gene Summary Chaperone protein which promotes assembly of the 20S proteasome as part of a heterodimer with PSMG2. The PSMG1-PSMG2 heterodimer binds to the PSMA5 and PSMA7 proteasome subunits, promotes assembly of the proteasome alpha subunits into the heteroheptameric alpha ring and prevents alpha ring dimerization.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) uses an alternate splice site in the coding region, but maintains the reading frame, compared to variant 1. The encoded isoform (3) is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...