Tropomyosin 2 (TPM2) (NM_001301227) Human Untagged Clone

CAT#: SC335070

TPM2 (untagged) - Human tropomyosin 2 (beta) (TPM2), transcript variant Tpm2.4



  "NM_001301227" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-TPM2 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AMCD1; DA1; DA2B; DA2B4; HEL-S-273; NEM4; TMSB
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001301227, the custom clone sequence may differ by one or more nucleotides


ATGGACGCCATCAAGAAGAAGATGCAGATGCTGAAGCTGGACAAGGAGAACGCCATCGACCGCGCCGAGC
AGGCCGAAGCCGACAAGAAGCAAGCTGAGGACCGCTGCAAGCAGCTGGAGGAGGAGCAGCAGGCCCTCCA
GAAGAAGCTGAAGGGGACAGAGGATGAGGTGGAAAAGTATTCTGAATCCGTGAAGGAGGCCCAGGAGAAA
CTGGAGCAGGCCGAGAAGAAGGCCACTGATGCTGAGGCAGATGTGGCCTCCCTGAACCGCCGCATTCAGC
TGGTTGAGGAGGAGCTGGACCGGGCCCAGGAGCGCCTGGCTACAGCCCTGCAGAAGCTGGAGGAGGCCGA
GAAGGCGGCTGATGAGAGCGAGAGAGGAATGAAGGTCATCGAAAACCGGGCCATGAAGGATGAGGAGAAG
ATGGAACTGCAGGAGATGCAGCTGAAGGAGGCCAAGCACATCGCTGAGGATTCAGACCGCAAATATGAAG
AGGTGGCCAGGAAGCTGGTGATCCTGGAAGGAGAGCTGGAGCGCTCGGAGGAGAGGGCTGAGGTGGCCGA
GAGCCGAGCCAGACAGCTGGAGGAGGAACTTCGAACCATGGACCAGGCCCTCAAGTCCCTGATGGCCTCA
GAGGAGGAGTATTCCACCAAAGAAGATAAATATGAAGAGGAGATCAAACTGTTGGAGGAGAAGCTGAAGG
AGGCTGAGACCCGAGCAGAGTTTGCCGAGAGGTCTGTGGCAAAGTTGGAGAAAACCATCGATGACCTAGA
AGATGAAGTCTATGCCCAGAAGATGAAGTACAAGGCCATTAGCGAGGAACTGGACAACGCACTCAATGAC
ATCACCTCCCTCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001301227
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001301227.1, NP_001288156.1
RefSeq Size 1327 bp
RefSeq ORF 855 bp
Locus ID 7169
Protein Pathways Cardiac muscle contraction, Dilated cardiomyopathy, Hypertrophic cardiomyopathy (HCM)
Gene Summary This gene encodes beta-tropomyosin, a member of the actin filament binding protein family, and mainly expressed in slow, type 1 muscle fibers. Mutations in this gene can alter the expression of other sarcomeric tropomyosin proteins, and cause cap disease, nemaline myopathy and distal arthrogryposis syndromes. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2009]
Transcript Variant: This variant (Tpm2.4, also known as variant 5) has an alternate in-frame exon in place of an internal exon compared to variant Tpm2.2. The resulting isoform (Tpm2.4, also known as isoform 5) has a different internal segment but has the same protein size as compared to isoform Tpm2.2st.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...