Chimaerin 2 (CHN2) (NM_001293080) Human Untagged Clone

CAT#: SC335098

CHN2 (untagged) - Human chimerin 2 (CHN2), transcript variant 13



  "NM_001293080" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-CHN2 Antibody
    • 50 ug

CNY 5,200.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ARHGAP3; BCH; CHN2-3; RHOGAP3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001293080, the custom clone sequence may differ by one or more nucleotides


ATGTTCTCTGAAGAACTGTGGCTGGAAAATGAGAAAAAGTGTGCTGTGGTTCGGAAGTCTAAGCAGGGCA
GGAAACGCCAAGAACTGCTGGCCGTAGCCTTCGGGGTGAAGGTGGGTGTCAAAGGCGGCTTTCTTTGGCC
CCCTCTCAAACTCTTTGCCTGTTCACAGATCTCCTCCCTGGTTCGAAGGGCTGCCCTCACACACAACGAC
AACCACTTCAATTATGAGAAGACACACAACTTTAAGGTCCACACGTTCCGAGGCCCACACTGGTGTGAAT
ATTGTGCCAATTTCATGTGGGGGCTCATCGCCCAAGGGGTCCGGTGCTCAGACTGTGGATTGAACGTACA
CAAACAGTGTTCCAAGCACGTTCCCAATGACTGCCAACCTGATCTCAAGAGGATCAAGAAAGTGTACTGT
TGTGACCTCACAACACTTGTGAAGGCTCACAACACTCAGAGACCCATGGTGGTAGACATATGCATTCGGG
AAATTGAAGCAAGAGGATTAAAATCGGAAGGCCTTTACAGAGTCTCTGGGTTCACTGAACACATTGAAGA
TGTCAAAATGGCATTTGACAGAGAAATCTCCAATGCAGATGAGAGGCTGGAAGCCGTCCATGAAGTGCTG
ATGCTGCTGCCTCCTGCCCACTATGAAACCCTCCGGTACCTAATGATCCACCTCAAAAAGGTTACTATGA
ATGAAAAAGACAATTTCATGAATGCAGAAAATCTGGGGATCGTGTTTGGGCCCACTCTGATGAGGCCCCC
TGAGGACAGCACCCTGACCACCCTGCATGATATGCGGTACCAAAAGCTGATTGTGCAGATTTTAATAGAA
AACGAAGACGTTTTATTCTAA


Restriction Sites SgfI-MluI     
ACCN NM_001293080
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001293080.1, NP_001280009.1
RefSeq Size 2877 bp
RefSeq ORF 861 bp
Locus ID 1124
UniProt ID P52757
Gene Summary This gene encodes a guanosine triphosphate (GTP)-metabolizing protein that contains a phorbol-ester/diacylglycerol (DAG)-type zinc finger, a Rho-GAP domain, and an SH2 domain. The encoded protein translocates from the cytosol to the Golgi apparatus membrane upon binding by diacylglycerol (DAG). Activity of this protein is important in cell proliferation and migration, and expression changes in this gene have been detected in cancers. A mutation in this gene has also been associated with schizophrenia in men. Alternative transcript splicing and the use of alternative promoters results in multiple transcript variants. [provided by RefSeq, May 2014]
Transcript Variant: This variant (13, also known as B1-CHNdel ex11) lacks an alternate in-frame exon, compared to variant 1. The encoded isoform (13) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...