Ikaros (IKZF1) (NM_001291840) Human Untagged Clone
CAT#: SC335120
IKZF1 (untagged) - Human IKAROS family zinc finger 1 (Ikaros) (IKZF1), transcript variant Ik-6
CNY 2,950.00
货期*
3周
规格
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
经常一起买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CVID13; Hs.54452; IK1; IKAROS; LyF-1; LYF1; PPP1R92; PRO0758; ZNFN1A1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001291840, the custom clone sequence may differ by one or more nucleotides
ATGGATGCTGATGAGGGTCAAGACATGTCCCAAGTTTCAGGGAAGGAAAGCCCCCCTGTAAGCGATACTC CAGATGAGGGCGATGAGCCCATGCCGATCCCCGAGGACCTCTCCACCACCTCGGGAGGACAGCAAAGCTC CAAGAGTGACAGAGTCGTGGGGGACAAGGGCCTGTCCGACACGCCCTACGACAGCAGCGCCAGCTACGAG AAGGAGAACGAAATGATGAAGTCCCACGTGATGGACCAAGCCATCAACAACGCCATCAACTACCTGGGGG CCGAGTCCCTGCGCCCGCTGGTGCAGACGCCCCCGGGCGGTTCCGAGGTGGTCCCGGTCATCAGCCCGAT GTACCAGCTGCACAAGCCGCTCGCGGAGGGCACCCCGCGCTCCAACCACTCGGCCCAGGACAGCGCCGTG GAGAACCTGCTGCTGCTCTCCAAGGCCAAGTTGGTGCCCTCGGAGCGCGAGGCGTCCCCGAGCAACAGCT GCCAAGACTCCACGGACACCGAGAGCAACAACGAGGAGCAGCGCAGCGGTCTCATCTACCTGACCAACCA CATCGCCCCGCACGCGCGCAACGGGCTGTCGCTCAAGGAGGAGCACCGCGCCTACGACCTGCTGCGCGCC GCCTCCGAGAACTCGCAGGACGCGCTCCGCGTGGTCAGCACCAGCGGGGAGCAGATGAAGGTGTACAAGT GCGAACACTGCCGGGTGCTCTTCCTGGATCACGTCATGTACACCATCCACATGGGCTGCCACGGCTTCCG TGATCCTTTTGAGTGCAACATGTGCGGCTACCACAGCCAGGACCGGTACGAGTTCTCGTCGCACATAACG CGAGGGGAGCACCGCTTCCACATGAGCTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001291840 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001291840.1, NP_001278769.1 |
RefSeq Size | 5373 bp |
RefSeq ORF | 870 bp |
Locus ID | 10320 |
UniProt ID | Q13422 |
Protein Families | Druggable Genome, Transcription Factors |
Gene Summary | This gene encodes a transcription factor that belongs to the family of zinc-finger DNA-binding proteins associated with chromatin remodeling. The expression of this protein is restricted to the fetal and adult hemo-lymphopoietic system, and it functions as a regulator of lymphocyte differentiation. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. Most isoforms share a common C-terminal domain, which contains two zinc finger motifs that are required for hetero- or homo-dimerization, and for interactions with other proteins. The isoforms, however, differ in the number of N-terminal zinc finger motifs that bind DNA and in nuclear localization signal presence, resulting in members with and without DNA-binding properties. Only a few isoforms contain the requisite three or more N-terminal zinc motifs that confer high affinity binding to a specific core DNA sequence element in the promoters of target genes. The non-DNA-binding isoforms are largely found in the cytoplasm, and are thought to function as dominant-negative factors. Overexpression of some dominant-negative isoforms have been associated with B-cell malignancies, such as acute lymphoblastic leukemia (ALL). [provided by RefSeq, May 2014] Transcript Variant: This variant (Ik-6) lacks four consecutive in-frame exons in the central coding region, compared to variant 1. The encoded isoform (Ik-6) is shorter than isoform 1. This isoform contains no N-terminal zinc finger motifs, is localized to the cytoplasm and functions as a non-DNA-binding, dominant-negative isoform (PMIDs:12937159, 10463586). Sequence Note: The 5' UTR of this variant is incomplete because there are no full-length transcripts supporting this variant, and there is splicing ambiguity in the 5' UTR. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...