MEMO1 (NM_001301833) Human Untagged Clone

CAT#: SC335172

MEMO1 (untagged) - Human mediator of cell motility 1 (MEMO1), transcript variant 3



  "NM_001301833" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-NCDN Antibody
    • 100 ul

CNY 5,250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C2orf4; CGI-27; MEMO; NS5ATP7
Vector pCMV6-Entry
Sequence Data
>SC335172 representing NM_001301833.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTCCAACCGAGTGGTCTGCCGAGAAGCCAGTCACGCCGGGAGCTGGTACACAGCCTCAGGACCGCAG
CTGAATGCACAGCTAGAAGGTTGGCTTTCACAAGTACAGTCTACAAAAAGACCTGCTAGAGCCATTATT
GCCCCCCATGCAGGATATACGTACTGTGGGTCTTGTGCTGCCCATGCTTATAAACAAGTGGATCCGTCT
ATTACCCGGAGAATTTTCATCCTTGGGCCTTCTCATCATGTGCCCCTCTCTCGATGTGCACTTTCCAGT
GTGGATATATATAGGACACCTCTGTATGACCTTCGTATTGACCAAAAGATTTACGGAGAACTGTGGAAG
ACAGGAATGTTTGAACGCATGTCTCTGCAGACAGATGAAGATGAACACAGTATTGAAATGCATTTGCCT
TATACAGCTAAAGCCATGGAAAGCCATAAGGATGAGTTTACCATTATTCCTGTACTGGTTGGAGCTCTG
AGTGAGTCAAAAGAACAGGAATTCGGAAAACTCTTCAGTAAATATCTAGCGGATCCTAGTAATCTCTTT
GTGGTTTCTTCTGATTTCTGCCATTGGGGTCAAAGGTTCCGTTACAGTTACTATGATGAATCCCAGGGG
GAGATTTATAGATCCATTGAACATCTAGATAAAATGGGTATGAGTATTATAGAACAATTAGACCCTGTA
TCTTTTAGCAATTACTTGAAGAAATACCATAATACTATATGTGGAAGACATCCCATTGGGGTGTTATTA
AATGCTATCACAGAGCTCCAGAAGAATGGAATGAATATGAGTTTTTCGTTTTTGAATTATGCCCAGTCG
AGCCAGTGTAGAAACTGGCAAGACAGTTCAGTGAGTTATGCAGCTGGAGCACTCACGGTCCACTGA

Restriction Sites SgfI-MluI     
ACCN NM_001301833
Insert Size 894 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001301833.1
RefSeq Size 1589 bp
RefSeq ORF 894 bp
Locus ID 51072
UniProt ID Q9Y316
MW 33.7 kDa
Gene Summary May control cell migration by relaying extracellular chemotactic signals to the microtubule cytoskeleton. Mediator of ERBB2 signaling. The MEMO1-RHOA-DIAPH1 signaling pathway plays an important role in ERBB2-dependent stabilization of microtubules at the cell cortex. It controls the localization of APC and CLASP2 to the cell membrane, via the regulation of GSK3B activity. In turn, membrane-bound APC allows the localization of the MACF1 to the cell membrane, which is required for microtubule capture and stabilization. Is required for breast carcinoma cell migration.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Both variants 1 and 3 encode the same isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...