DNASE1L2 (NM_001301680) Human Untagged Clone

CAT#: SC335188

DNASE1L2 (untagged) - Human deoxyribonuclease I-like 2 (DNASE1L2), transcript variant 2



  "NM_001301680" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


DNASE1L2 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DNAS1L2
Vector pCMV6-Entry
Sequence Data
>SC335188 representing NM_001301680.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGGCGGGCCCCGGGCTCTGCTGGCCGCACTCTGGGCGCTGGAAGCCGCCGGGACCGCCGCGCTTCGC
ATCGGAGCCTTCAACATTCAGAGCTTCGGTGACAGCAAAGTGTCGGACCCCGCTTGCGGCAGCATCATC
GCGAAGATCCTGGCTGGCTATGACCTCGCGCTGGTGCAGGAGGTGCGAGACCCAGACCTCAGCGCCGTG
TCCGCGCTCATGGAGCAGATCAACAGCGTGTCCGAGCACGAGTACAGCTTTGTGAGCAGCCAGCCCCTG
GGCCGGGACCAGTACAAGGAGATGTACCTGTTCGTGTACAGGAAAGACGCGGTGTCGGTCGTGGACACC
TACCTGTACCCAGACCCCGAGGACGTCTTCAGCCGCGAGCCCTTCGTGGTCAAGTTCTCGGCCCCCGGC
ACCGGTGAGCGGGCCCCGCCCCTCCCCTCCCGCCGAGCTCTGACGCCCCCACCCCTTCCCGCAGCAGCA
CAGAACCTGGTGCTGATCCCGCTGCACGCGGCGCCGCATCAAGCCGTGGCGGAGATCGACGCGCTCTAC
GACGTGTACCTGGACGTGATCGACAAGTGGGGCACCGACGACATGCTGTTCCTGGGCGACTTCAACGCC
GACTGCAGCTATGTGCGGGCGCAGGACTGGGCCGCCATCCGTCTGAGGAGCAGTGAGGTCTTCAAGTGG
CTCATCCCTGACAGCGCCGACACCACGGTGGGCAACTCAGACTGCGCCTACGACCGCATTGTGGCCTGT
GGCGCCCGCCTGCGCCGGAGCCTGAAGCCCCAGTCGGCCACCGTGCACGACTTCCAGGAGGAATTCGGC
CTGGACCAGACTCAGGCTCTTGCCATCAGCGACCACTTTCCAGTGGAGGTGACCCTCAAGTTCCACCGA
TGA

Restriction Sites SgfI-MluI     
ACCN NM_001301680
Insert Size 900 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001301680.1
RefSeq Size 1342 bp
RefSeq ORF 900 bp
Locus ID 1775
UniProt ID Q92874
Protein Families Secreted Protein
MW 32.9 kDa
Gene Summary Divalent cation-dependent acid DNA endonuclease involved in the breakdown of the nucleus during corneocyte formation of epidermal keratinocytes. May play an immune role by eliminating harmful DNA released into the extracellular environment by damaged epidermal cells.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...