WDR61 (NM_001303247) Human Untagged Clone

CAT#: SC335225

WDR61 (untagged) - Human WD repeat domain 61 (WDR61), transcript variant 1



  "NM_001303247" in other vectors (2)

CNY 3,040.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


WDR61 mouse monoclonal antibody, clone OTI2H10 (formerly 2H10)
    • 100 ul

CNY 1,999.00
CNY 2,700.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms REC14; SKI8
Vector pCMV6-Entry
Sequence Data
>SC335225 representing NM_001303247.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGACCAACCAGTACGGTATTCTCTTCAAACAAGAGCAAGCCCATGATGATGCCATTTGGTCAGTTGCT
TGGGGGACAAACAAGAAGGAAAACTCTGAGACAGTGGTCACAGGCTCCCTAGATGACCTGGTGAAGGTC
TGGAAATGGCGTGATGAGAGGCTGGACCTACAGTGGAGTCTGGAGGGACATCAGCTGGGAGTGGTGTCT
GTGGACATCAGCCACACCCTGCCCATTGCTGCATCCAGCTCTCTTGATGCTCATATTCGTCTTTGGGAC
TTGGAAAATGGCAAACAGATAAAGTCCATAGATGCAGGACCTGTGGATGCCTGGACTTTGGCCTTTTCT
CCTGATTCCCAGTATCTGGCCACAGGAACTCATGTCGGGAAAGTGAACATTTTTGGTGTGGAAAGTGGG
AAAAAGGAATATTCTTTGGACACGAGAGGAAAATTCATTCTTAGTATTGCATATAGTCCTGATGGGAAA
TACCTAGCCAGTGGAGCCATAGATGGAATCATCAATATTTTTGATATTGCAACTGGAAAACTTCTGCAT
ACCCTGGAAGGCCATGCCATGCCCATTCGCTCCTTGACCTTTTCCCCGGACTCCCAGCTCCTTGTCACT
GCTTCAGATGATGGCTACATCAAGATCTATGATGTACAACATGCCAATTTGGCTGGCACGCTGAGCGGC
CATGCCTCCTGGGTGCTGAACGTTGCATTCTGTCCTGATGACACTCACTTTGTTTCCAGTTCGTCTGAC
AAAAGTGTAAAAGTTTGGGATGTTGGAACGAGGACTTGTGTTCACACCTTCTTTGATCACCAGGATCAG
GTCTGGGGAGTAAAATACAATGGAAATGGTTCAAAAATTGTGTCTGTTGGAGATGACCAGGAAATTCAC
ATCTATGATTGTCCAATTTAA

Restriction Sites SgfI-MluI     
ACCN NM_001303247
Insert Size 918 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001303247.1
RefSeq Size 1439 bp
RefSeq ORF 918 bp
Locus ID 80349
UniProt ID Q9GZS3
Protein Pathways RNA degradation
MW 33.6 kDa
Gene Summary WDR61 is a subunit of the human PAF and SKI complexes, which function in transcriptional regulation and are involved in events downstream of RNA synthesis, such as RNA surveillance (Zhu et al., 2005 [PubMed 16024656]).[supplied by OMIM, Mar 2008]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (a). Variants 1 and 2 both encode isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...