NPSR1 (NM_001300934) Human Untagged Clone

CAT#: SC335233

NPSR1 (untagged) - Human neuropeptide S receptor 1 (NPSR1), transcript variant 4



  "NM_001300934" in other vectors (2)

CNY 2,640.00

CNY 3,040.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
NPSR1 / NPSR Rabbit Polyclonal (Extracellular Domain) Antibody
    • 50 ug

CNY 5,654.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ASRT2; GPR154; GPRA; NPSR; PGR14; VRR1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335233 representing NM_001300934.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCCAGCCAACTTCACAGAGGGCAGCTTCGATTCCAGTGGGACCGGGCAGACGCTGGATTCTTCCCCA
GTGGCTTGCACTGAAACAGTGACTTTTACTGAAGTGGTGGAAGGAAAGGAATGGGGTTCCTTCTACTAC
TCCTTTAAGACTGAGCAATTGATAACTCTGTGGGTCCTCTTTGTTTTTACCATTGTTGGAAACTCCGTT
GTGCTTTTTTCCACATGGAGGAGAAAGAAGAAGTCAAGAATGACCTTCTTTGTGACTCAGCTGGCCATC
ACAGAAAAGCAAGCCAGGGTCCTCATTGTGATCGCCTGGAGCCTGTCTTTTCTGTTCTCCATTCCCACC
CTGATCATATTTGGGAAGAGGACACTGTCCAACGGTGAAGTGCAGTGCTGGGCCCTGTGGCCTGACGAC
TCCTACTGGACCCCATACATGACCATCGTGGCCTTCCTGGTGTACTTCATCCCTCTGACAATCATCAGC
ATCATGTATGGCATTGTGATCCGAACTATTTGGATTAAAAGCAAAACCTACGAAACAGTGATTTCCAAC
TGCTCAGATGGGAAACTGTGCAGCAGCTATAACCGAGGACTCATCTCAAAGGCAAAAATCAAGGCTATC
AAGTATAGCATCATCATCATTCTTGCCTTCATCTGCTGTTGGAGTCCATACTTCCTGTTTGACATTTTG
GACAATTTCAACCTCCTTCCAGACACCCAGGAGCGTTTCTATGCCTCTGTGATCATTCAGAACCTGCCA
GCATTGAATAGTGCCATCAACCCCCTCATCTACTGTGTCTTCAGCAGCTCCATCTCTTTCCCCTGCAGG
GAGCAAAGATCACAGGATTCCAGAATGACGTTCCGGGAGAGAACTGAGAGGCATGAGATGCAGATTCTG
TCCAAGCCAGAATTCATCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001300934
Insert Size 918 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001300934.1
RefSeq Size 1415 bp
RefSeq ORF 918 bp
Locus ID 387129
UniProt ID Q6W5P4
Protein Families Druggable Genome, Transmembrane
MW 35.1 kDa
Gene Summary This gene encodes a member of the vasopressin/oxytocin subfamily of G protein-coupled receptors. The encoded membrane protein acts as a receptor for neuropeptide S and affects a variety of cellular processes through its signaling. Increased expression of this gene in ciliated cells of the respiratory epithelium and in bronchial smooth muscle cells is associated with asthma. Polymorphisms in this gene have also been associated with asthma susceptibility, panic disorders, inflammatory bowel disease, and rheumatoid arthritis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
Transcript Variant: This variant (4) lacks two consecutive in-frame exons in the central coding region, compared to variant 1. The encoded isoform (F, PMID: 15947423) is shorter, compared to isoform A.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...