ICOS Ligand (ICOSLG) (NM_001283050) Human Untagged Clone

CAT#: SC335253

ICOSLG (untagged) - Human inducible T-cell co-stimulator ligand (ICOSLG), transcript variant 2



  "NM_001283050" in other vectors (2)

CNY 3,040.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
ICOSLG mouse monoclonal antibody, clone OTI2C5 (formerly 2C5)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms B7-H2; B7h; B7H2; B7RP-1; B7RP1; CD275; GL50; ICOS-L; ICOSL; LICOS
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335253 representing NM_001283050.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCGGCTGGGCAGTCCTGGACTGCTCTTCCTGCTCTTCAGCAGCCTTCGAGCTGATACTCAGGAGAAG
GAAGTCAGAGCGATGGTAGGCAGCGACGTGGAGCTCAGCTGCGCTTGCCCTGAAGGAAGCCGTTTTGAT
TTAAATGATGTTTACGTATATTGGCAAACCAGTGAGTCGAAAACCGTGGTGACCTACCACATCCCACAG
AACAGCTCCTTGGAAAACGTGGACAGCCGCTACCGGAACCGAGCCCTGATGTCACCGGCCGGCATGCTG
CGGGGCGACTTCTCCCTGCGCTTGTTCAACGTCACCCCCCAGGACGAGCAGAAGTTTCACTGCCTGGTG
TTGAGCCAATCCCTGGGATTCCAGGAGGTTTTGAGCGTTGAGGTTACACTGCATGTGGCAGCAAACTTC
AGCGTGCCCGTCGTCAGCGCCCCCCACAGCCCCTCCCAGGATGAGCTCACCTTCACGTGTACATCCATA
AACGGCTACCCCAGGCCCAACGTGTACTGGATCAATAAGACGGACAACAGCCTGCTGGACCAGGCTCTG
CAGAATGACACCGTCTTCTTGAACATGCGGGGCTTGTATGACGTGGTCAGCGTGCTGAGGATCGCACGG
ACCCCCAGCGTGAACATTGGCTGCTGCATAGAGAACGTGCTTCTGCAGCAGAACCTGACTGTCGGCAGC
CAGACAGGAAATGACATCGGAGAGAGAGACAAGATCACAGAGAATCCAGTCAGTACCGGCGAGAAAAAC
GCGGCCACGTGGAGCATCCTGGCTGTCCTGTGCCTGCTTGTGGTCGTGGCGGTGGCCATAGGCTGGGTG
TGCAGGGACCGATGCCTCCAACACAGCTATGCAGGTGCCTGGGCTGTGAGTCCGGAGACAGAGCTCACT
GAATCCTGGAACCTGCTCCTTCTGCTCTCGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001283050
Insert Size 930 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001283050.1
RefSeq Size 1188 bp
RefSeq ORF 930 bp
Locus ID 23308
UniProt ID O75144
Protein Families Transmembrane
Protein Pathways Cell adhesion molecules (CAMs)
MW 34.2 kDa
Gene Summary Ligand for the T-cell-specific cell surface receptor ICOS. Acts as a costimulatory signal for T-cell proliferation and cytokine secretion; induces also B-cell proliferation and differentiation into plasma cells. Could play an important role in mediating local tissue responses to inflammatory conditions, as well as in modulating the secondary immune response by co-stimulating memory T-cell function (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) uses an alternate 3' terminal exon and it thus differs in the 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (b) has a distinct and longer C-terminus, compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...