ACSF3 (NM_001284316) Human Untagged Clone

CAT#: SC335262

ACSF3 (untagged) - Human acyl-CoA synthetase family member 3 (ACSF3), transcript variant 3



  "NM_001284316" in other vectors (2)

CNY 3,040.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-ACSF3 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335262 representing NM_001284316.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGATGCCTGAGTTCAGCCCTCAGCAGGTTTGGGAAAAGTTCTTAAGTTCTGAAACGCCGCGGATCAAT
GTCTTTATGGCAGTGCCTACAATATACACCAAGCTGATGGAGTACTACGACAGGCATTTTACCCAGCCG
CACGCCCAGGATTTCTTGCGTGCAGTTTGTGAAGAAAAAATTAGGCTGATGGTCTCAGGCTCAGCTGCC
CTGCCCCTCCCAGTGCTGGAGAAGTGGAAGAACATCACGGGCCACACCCTGCTGGAGCGGTATGGCATG
ACCGAGATCGGCATGGCTCTGTCCGGGCCCCTGACCACTGCCGTGCGCCTGCCAGGTTCCGTGGGGACC
CCACTGCCTGGAGTACAGGTGCGCATTGTCTCAGAAAACCCACAGAGGGAAGCCTGCTCCTACACCATC
CACGCAGAGGGAGACGAGAGGGGGACCAAGGTGACCCCAGGGTTTGAAGAAAAGGAGGGGGAGCTGCTG
GTGAGGGGACCCTCCGTGTTTCGAGAATACTGGAATAAACCAGAAGAAACTAAGAGTGCATTCACCCTG
GATGGCTGGTTTAAGACAGGGGACACCGTGGTGTTTAAGGATGGCCAGTACTGGATCCGAGGCCGGACC
TCAGTGGACATCATCAAGACTGGAGGCTACAAGGTCAGCGCCCTGGAGGTGGAGTGGCACCTGCTGGCC
CACCCCAGCATCACAGATGTGGCTGTGATTGGAGTTCCGGATATGACATGGGGCCAGCGGGTCACTGCT
GTGGTGACCCTCCGAGAAGGACACTCACTGTCCCACAGGGAGCTCAAAGAGTGGGCCAGAAATGTCCTG
GCCCCGTACGCGGTGCCCTCGGAGCTGGTGCTGGTGGAGGAGATCCCGCGGAACCAGATGGGCAAGATT
GACAAGAAGGCGCTCATCAGGCACTTCCACCCCTCATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001284316
Insert Size 936 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001284316.1
RefSeq Size 2888 bp
RefSeq ORF 936 bp
Locus ID 197322
MW 35.1 kDa
Gene Summary This gene encodes a member of the acyl-CoA synthetase family of enzymes that activate fatty acids by catalyzing the formation of a thioester linkage between fatty acids and coenzyme A. The encoded protein is localized to mitochondria, has high specificity for malonate and methylmalonate and possesses malonyl-CoA synthetase activity. Mutations in this gene are a cause of combined malonic and methylmalonic aciduria. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Sep 2013]
Transcript Variant: This variant (3) lacks two exons, one of which contains a portion of the 5' UTR and the other which contains a portion of the 5' coding region including the start codon, compared to variant 1. These differences cause translation initiation at a downstream start codon and result in an isoform (2) with a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...