CGK2 (PRKG2) (NM_001282482) Human Untagged Clone

CAT#: SC335275

PRKG2 (untagged) - Human protein kinase, cGMP-dependent, type II (PRKG2), transcript variant 4



  "NM_001282482" in other vectors (2)

CNY 3,040.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
PRKG2 mouse monoclonal antibody,clone OTI10D5
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms cGK2; cGKII; PKG2; PRKGR2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335275 representing NM_001282482.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCTAACTGGAAGCTGTCCAAAGCACTCTCTCTGGAAATGATTCAGCTGAAGGAGAAGGTTAAAGTA
AAAAATGAGAATGTTGCTTTTGCTATGAAGTGTATAAGGAAGAAGCACATAGTTGACACCAAGCAGCAG
GAGCATGTCTACTCAGAGAAGAGGATCCTAGAGGAGCTGTGCTCTCCATTCATTGTGAAATTATATCGT
ACTTTCAAGGACAATAAGTATGTATACATGCTTCTGGAGGCCTGCTTAGGTGGGGAGCTCTGGAGTATA
TTAAGGGACAGAGGCAGCTTTGATGAACCCACCTCCAAATTCTGCGTTGCTTGTGTGACAGAAGCATTT
GATTACCTGCATCGACTAGGTATTATCTACAGAGACTTGAAACCAGAAAACTTAATTCTAGATGCTGAG
GGTTACCTTAAATTGGTTGACTTTGGATTTGCGAAGAAAATAGGGTCTGGACAGAAAACATGGACATTC
TGTGGGACTCCAGAATATGTAGCTCCTGAAGTCATTCTCAACAAGGGACATGACTTCAGTGTGGATTTC
TGGTCACTGGGAATTCTAGTGTATGAGCTCCTAACGGGCAACCCACCCTTTTCTGGGGTTGACCAAATG
ATGACCTACAATTTGATTCTCAAAGGAATTGAAAAAATGGATTTTCCCAGGAAGATAACACGACGACCT
GAGGATTTGATTCGGAGGCTTTGCAGGCAAAATCCAACAGAAAGGCTGGGAAATCTGAAGAATGGAATA
AATGACATTAAGAAACACAGGTGGTTAAATGGTTTTAATTGGGAGGGACTGAAAGCACGGAGCCTTCCA
TCACCTTTGCAAAGAGAGCTCAAGGGACCCATAGATCACAGCTACTTTGACAAATATCCTCCTGAAAAG
GGAATGCCTCCAGATGAGCTATCAGGCTGGGATAAAGACTTCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001282482
Insert Size 942 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001282482.1
RefSeq Size 3684 bp
RefSeq ORF 942 bp
Locus ID 5593
UniProt ID Q13237
Protein Families Druggable Genome, Protein Kinase
Protein Pathways Gap junction, Long-term depression, Olfactory transduction
MW 36.4 kDa
Gene Summary This gene encodes a protein that belongs to the serine/threonine protein kinase family of proteins. The encoded protein binds to and inhibits the activation of several receptor tyrosine kinases. The membrane-bound protein is a regulator of intestinal secretion, bone growth and renin secretion. Alternate splicing results in multiple transcript variants encoding distinct isoforms whose regulatory N-termini differ in length but whose C-terminal catalytic domains are identical. [provided by RefSeq, May 2018]
Transcript Variant: This variant (4) represents the use of an alternate promoter, and has multiple differences compared to variant 1. These differences result in a distinct 5' UTR and cause translation initiation at a downstream start codon compared to variant 1. The resulting isoform (c) has a shorter N-terminus compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...