PSG9 (NM_001301707) Human Untagged Clone

CAT#: SC335406

PSG9 (untagged) - Human pregnancy specific beta-1-glycoprotein 9 (PSG9), transcript variant 2



  "NM_001301707" in other vectors (2)

CNY 3,230.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-PSG9 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PS34; PSBG-9; PSBG-11; PSG11; PSGII
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335406 representing NM_001301707.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGGCCCCTCCCAGCCCCTTCCTGCACACAGCGCATCACCTGGAAGGGGCTCCTGCTCACAGCATCA
CTTTTAAACTTCTGGAACCCGCCCACCACTGCCGAAGTCACGATTGAAGCCCAGCCACCCAAAGTTTCT
GAGGGGAAGGATGTTCTTCTACTTGTCCACAATTTGCCCCAGAATCTTCCTGGCTACTTCTGGTACAAA
GGGGAAATGACGGACCTCTACCATTACATTATATCGTATATAGTTGATGGTAAAATAATTATATATGGG
CCTGCATACAGTGGAAGAGAAACAGTATATTCCAACGCATCCCTGCTGATCCAGAATGTCACCCGGAAG
GATGCAGGAACCTACACCTTACACATCATAAAGCGAGGTGATGAGACTAGAGAAGAAATTCGACATTTC
ACCTTCACCTTATACTCGAAGCTGCCCATCCCCTACATCACCATCAACAACTTAAACCCCAGGGAGAAT
AAGGATGTCTTAGCCTTCACCTGTGAACCTAAGAGTGAGAACTACACCTACATTTGGTGGCTAAACGGT
CAGAGCCTCCCCGTCAGTCCCGGGGTAAAGCGACCCATTGAAAACAGGATACTCATTCTACCCAGTGTC
ACGAGAAATGAAACAGGACCCTATCAATGTGAAATACGGGACCGATATGGTGGCCTCCGCAGTAACCCA
GTCATCCTAAATGTCCTCTATGGTCCAGACCTCCCCAGAATTTACCCTTCATTCACCTATTACCGTTCA
GGAGAAAACCTCGACTTGTCCTGCTTCACGGAATCTAACCCACCGGCAGAGTATTTTTGGACAATTAAT
GGGAAGTTTCAGCAATCAGGACAAAAGCTCTTTATCCCCCAAATTACTAGAAATCATAGCGGGCTCTAT
GCTTGCTCTGTTCATAACTCAGCCACTGGCAAGGAAATCTCCAAATCCATGACAGTCAAAGTCTCTGGT
CCCTGCCATGGAGACCTGACAGAGTCTCAGTCATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001301707
Insert Size 1002 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001301707.1
RefSeq Size 1488 bp
RefSeq ORF 1002 bp
Locus ID 5678
UniProt ID Q00887
Protein Families Secreted Protein
MW 37.7 kDa
Gene Summary The protein encoded by this gene is a member of the pregnancy-specific glycoprotein (PSG) family. This protein family and the closely related carcinoembryonic antigen cell adhesion molecule (CEACAM) gene family are both members of the immunoglobulin superfamily, and are organized as a large gene cluster. This protein is thought to inhibit platelet-fibrinogen interactions. Several studies suggest that reduced serum concentrations of PSGs are associated with fetal growth restrictions, while up-regulation of this gene has been observed in colorectal cancers. Several pseudogenes of this gene are found on chromosome 19. Alternative splicing results in multiple transcript variants that encode multiple protein isoforms. [provided by RefSeq, Sep 2014]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the coding region, compared to variant 1. It encodes isoform 2 which is shorter than isoform 1. Variants 2 and 3 encode isoforms of the same size, but contain internal differences.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...