Sex Hormone Binding Globulin (SHBG) (NM_001289113) Human Untagged Clone

CAT#: SC335487

SHBG (untagged) - Human sex hormone-binding globulin (SHBG), transcript variant 5



  "NM_001289113" in other vectors (2)

CNY 3,330.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
SHBG mouse monoclonal antibody, clone OTI1H10 (formerly 1H10)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ABP; SBP; TEBG
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335487 representing NM_001289113.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGACCTTTGACCTCACCAAGATCACAAAAACCTCCTCCTCCTTTGAGGTTCGAACCTGGGACCCAGAG
GGAGTGATTTTTTATGGGGATACCAACCCTAAGGATGACTGGTTTATGCTGGGACTTCGAGACGGCAGG
CCTGAGATCCAACTGCACAATCACTGGGCCCAGCTTACGGTGGGTGCTGGACCACGGCTGGATGATGGG
AGATGGCACCAGGTGGAAGTCAAGATGGAGGGGGACTCTGTGCTGCTGGAGGTGGATGGGGAGGAGGTG
CTGCGCCTGAGACAGGTCTCTGGGCCCCTGACCAGCAAACGCCATCCCATCATGAGGATTGCGCTTGGG
GGGCTGCTCTTCCCCGCTTCCAACCTTCGGTTGCCGCTGGTTCCTGCCCTGGATGGCTGCCTGCGCCGG
GATTCCTGGCTGGACAAACAGGCCGAGATCTCAGCATCTGCCCCCACTAGCCTCAGAAGCTGTGATGTA
GAATCAAATCCCGGGATATTTCTCCCTCCAGGGACTCAGGCAGAATTCAATCTCCGAGACATTCCCCAG
CCTCATGCAGAGCCCTGGGCCTTCTCTTTGGACCTGGGACTCAAGCAGGCAGCAGGCTCAGGCCACCTC
CTTGCTCTTGGGACACCAGAGAACCCATCTTGGCTCAGTCTCCACCTCCAAGATCAAAAGGTGGTGTTG
TCTTCTGGGTCGGGGCCAGGGCTGGATCTGCCCCTGGTCTTGGGACTCCCTCTTCAGCTGAAGCTGAGT
ATGTCCAGGGTGGTCTTGAGCCAAGGGTCGAAGATGAAGGCCCTTGCCCTGCCTCCCTTAGGCCTGGCT
CCCCTCCTTAACCTCTGGGCCAAGCCTCAAGGGCGTCTCTTCCTGGGGGCTTTACCAGGAGAAGACTCT
TCCACCTCTTTTTGCCTGAATGGCCTTTGGGCACAAGGTCAGAGGCTGGATGTGGACCAGGCCCTGAAC
AGAAGCCATGAGATCTGGACTCACAGCTGCCCCCAGAGCCCAGGCAATGGCACTGACGCTTCCCATTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001289113
Insert Size 1035 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001289113.1
RefSeq Size 1326 bp
RefSeq ORF 1035 bp
Locus ID 6462
UniProt ID P04278
Protein Families Druggable Genome, Secreted Protein
MW 37.5 kDa
Gene Summary This gene encodes a steroid binding protein that was first described as a plasma protein secreted by the liver but is now thought to participate in the regulation of steroid responses. The encoded protein transports androgens and estrogens in the blood, binding each steroid molecule as a dimer formed from identical or nearly identical monomers. Polymorphisms in this gene have been associated with polycystic ovary syndrome and type 2 diabetes mellitus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Transcript Variant: This variant (5) differs in the 5' UTR, lacks part of the 5' coding region, and uses a downstream start codon, compared to variant 1. The encoded isoform (5) has a shorter N-terminus, compared to isoform 1. Both variants 5 and 6 encode the same isoform.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

其它Sex Hormone Binding Globulin产品

Customer Reviews 
Loading...