ZKSCAN1 (NM_001287055) Human Untagged Clone

CAT#: SC335532

ZKSCAN1 (untagged) - Human zinc finger with KRAB and SCAN domains 1 (ZKSCAN1), transcript variant 3



  "NM_001287055" in other vectors (2)

CNY 3,420.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
ZKSCAN1 mouse monoclonal antibody,clone OTI2C9
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms KOX18; PHZ-37; ZNF36; ZNF139; ZSCAN33
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335532 representing NM_001287055.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCATCTGCACTATTCACAGCGGATTCCCAGGCAATGGTGAAGATCGAGGACATGGCTGTGTCCCTC
ATTCTGGAGGAATGGGGATGTCAGAATCTGGCTCGGAGGAATCTCAGTAGGGACAACAGGCAGGAGAAT
TATGGGAGCGCATTTCCCCAGGGTGGTGAAAACAGGAATGAGAACGAGGAGTCAACCTCAAAGGCTGAA
ACCTCGGAAGATTCAGCATCACGCGGGGAGACAACAGGAAGATCCCAGAAAGAGTTTGGAGAGAAACGT
GACCAGGAGGGCAAAACAGGAGAAAGACAGCAGAAAAACCCTGAGGAGAAAACCAGGAAAGAGAAAAGA
GATTCAGGGCCAGCTATAGGAAAGGACAAAAAAACCATCACAGGAGAGAGAGGTCCAAGGGAGAAGGGG
AAAGGATTGGGAAGAAGCTTCAGTCTGAGCTCCAACTTCACCACCCCTGAAGAAGTTCCCACGGGAACA
AAGTCTCACAGATGTGATGAATGTGGTAAATGCTTCACGAGAAGTTCAAGCCTTATCCGCCATAAAATA
ATCCACACTGGAGAAAAGCCCTATGAATGTAGTGAGTGTGGGAAAGCCTTCAGTCTTAACTCCAACCTT
GTCCTGCATCAGAGGATCCACACAGGAGAGAAACCTCATGAATGTAACGAGTGTGGCAAGGCCTTCAGC
CACAGTTCCAATCTCATCCTCCATCAGCGCATCCACTCTGGAGAGAAACCTTATGAATGTAATGAGTGC
GGGAAGGCCTTCAGCCAGAGCTCGGACCTCACCAAGCATCAGAGAATTCACACGGGGGAGAAACCCTAT
GAATGTAGTGAATGTGGAAAAGCTTTCAACCGAAACTCATACCTGATTTTGCATCGGAGAATTCACACT
CGAGAAAAGCCCTACAAGTGCACTAAGTGTGGCAAGGCCTTCACCCGCAGCTCCACCCTCACTCTGCAT
CACAGAATCCATGCCAGAGAGAGAGCCTCTGAGTACAGCCCAGCCTCCCTTGATGCATTTGGCGCGTTC
CTGAAAAGTTGTGTGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001287055
Insert Size 1053 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001287055.1
RefSeq Size 8776 bp
RefSeq ORF 1053 bp
Locus ID 7586
Protein Families Transcription Factors
MW 39.3 kDa
Gene Summary This gene encodes a member of the Kruppel C2H2-type zinc-finger family of proteins. This encoded protein may function as a transcription factor that regulates the expression of GABA type-A receptors in the brain. Transcripts from this gene have been shown to form stable and abundant circular RNAs. Elevated expression of this gene has been observed in gastric cancer and the encoded protein may stimulate migration and invasion of human gastric cancer cells. [provided by RefSeq, Oct 2016]
Transcript Variant: This variant (3) differs in its 5' UTR, lacks a portion of the 5' coding region and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (c) is shorter at the N-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...