NDRG2 (NM_001282213) Human Untagged Clone

CAT#: SC335583

NDRG2 (untagged) - Human NDRG family member 2 (NDRG2), transcript variant 11



  "NM_001282213" in other vectors (2)

CNY 3,420.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-NDRG2 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms SYLD
Vector pCMV6-Entry
Sequence Data
>SC335583 representing NM_001282213.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCGGAGCTGCAGGAGGTGCAGATCACAGAGGAGAAGCCACTGTTGCCAGGACAGACGCCTGAGGCG
GCCAAGACTCACTCTGTGGAGACACCATACGGCTCTGTCACTTTCACTGTCTATGGCACCCCCAAACCC
AAACGCCCAGCGATCCTTACCTACCACGATGTGGGACTCAACTATAAATCTTGCTTCCAGCCACTGTTT
CAGTTCGAGGACATGCAGGAAATCATTCAGAACTTTGTGCGGGTTCATGTGGATGCCCCTGGAATGGAA
GAGGGAGCCCCTGTGTTCCCTTTGGGATATCAGTACCCATCTCTGGACCAGCTTGCAGACATGATCCCT
TGCGTCCTGCAGTACCTAAATTTCTCTACAATAATTGGAGTTGGTGTTGGAGCTGGAGCCTACATCCTG
GCGAGATATGCTCTTAACCACCCGGACACTGTTGAAGGTCTTGTCCTCATCAACATTGATCCCAATGCC
AAGGGTTGGATGGATTGGGCAGCCCACAAGCTAACAGGCCTCACCTCTTCCATTCCGGAGATGATCCTT
GGACATCTTTTCAGCCAGGAAGAGCTCTCTGGAAATTCTGAGTTGATACAAAAGTACAGAAATATCATT
ACACATGCACCCAACCTGGATAACATTGAATTGTACTGGAACAGCTACAACAACCGCCGAGACCTGAAC
TTTGAGCGTGGAGGTGATATCACCCTCAGGTGTCCTGTGATGCTGGTGGTAGGAGACCAAGCACCTCAT
GAAGATGCAGTGGTGGAATGTAACTCAAAACTGGACCCCACCCAGACCTCGTTCCTCAAGATGGCTGAC
TCCGGAGGTCAGCCCCAGCTGACTCAGCCAGGCAAGCTGACCGAGGCCTTCAAGTACTTCCTGCAAGGC
ATGGGCTACATGGCCTCATCCTGCATGACTCGCCTGTCCCGGTCTCGTACAGCCTCTCTGACCAGTGCA
GCATCCGTTGATGGCAACCGGTCCCGCTCTCGCACCCTGTCCCAGAGCAGCGAGTCTGGAACTCTTTCT
TCGGGGCCCCCGGGGCACACCATGGAGGTCTCCTGTTGA

Restriction Sites SgfI-MluI     
ACCN NM_001282213
Insert Size 1074 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001282213.1
RefSeq Size 2257 bp
RefSeq ORF 1074 bp
Locus ID 57447
UniProt ID Q9UN36
MW 39.3 kDa
Gene Summary This gene is a member of the N-myc downregulated gene family which belongs to the alpha/beta hydrolase superfamily. The protein encoded by this gene is a cytoplasmic protein that may play a role in neurite outgrowth. This gene may be involved in glioblastoma carcinogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2017]
Transcript Variant: This variant (11) differs in the 5' UTR and lacks an alternate in-frame internal exon compared to variant 1. The resulting isoform (b) lacks an alternate internal segment compared to isoform a. Variants 2, 3, 5, 8, 11, and 12 all encode the same isoform (b).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...