CERD4 (DPF3) (NM_001280543) Human Untagged Clone

CAT#: SC335657

DPF3 (untagged) - Human D4, zinc and double PHD fingers, family 3 (DPF3), transcript variant 3



  "NM_001280543" in other vectors (2)

CNY 4,024.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-DPF3 Antibody
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BAF45C; CERD4
Vector PCMV6-Neo
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001280543, the custom clone sequence may differ by one or more nucleotides


ATGGGGTTCACAGACCTGGAAGAGCCCATCTCTGGATGCCCTGGAGGCCCATGGGCTCTAGGGCTCGGGG
ACCAGTTCTACAAGGAAGCCATTGAGCACTGCCGGAGTTACAACTCACGGCTGTGTGCAGAGCGCAGCGT
GCGTCTTCCCTTCCTGGACTCACAGACTGGGGTGGCCCAGAACAACTGCTACATCTGGATGGAGAAGAGG
CACCGAGGCCCAGGCCTTGCCCCGGGCCAGCTGTATACATACCCTGCCCGCTGCTGGCGCAAGAAGAGAC
GATTGCACCCACCTGAAGATCCAAAACTGCGGCTGCTGGAGATAAAACCTGAAGTGGAGCTTCCCCTGAA
GAAGGATGGGTTCACCTCAGAGAGCACCACGCTGGAAGCCTTGCTCCGTGGCGAGGGGGTTGAGAAGAAG
GTGGATGCCAGGGAGGAGGAAAGCATCCAGGAAATACAGAGGGTTTTGGAAAATGATGAAAATGTAGAAG
AAGGGAATGAAGAAGAGGATTTGGAAGAGGATATTCCCAAGCGAAAGAACAGGACTAGAGGACGGGCTCG
CGGCTCTGCAGGGGGCAGGAGGAGGCACGACGCCGCCTCTCAGGAAGACCACGACAAACCTTACGTCTGT
GACATCTGTGGCAAGCGCTACAAGAACCGACCGGGGCTCAGCTACCACTATGCTCACACTCACCTGGCCA
GCGAGGAGGGGGATGAAGCTCAAGACCAGGAGACTCGGTCCCCACCCAACCACAGAAATGAGAACCACAG
GCCCCAGAAAGGACCGGATGGAACAGTCATTCCCAATAACTACTGTGACTTCTGCTTGGGGGGCTCCAAC
ATGAACAAGAAGAGTGGGCGGCCTGAAGAGCTGGTGTCCTGCGCAGACTGTGGACGCTCTGCTCATTTGG
GAGGAGAAGGCAGGAAGGAGAAGGAGGCAGCGGCCGCAGCACGTACCACGGAGGACTTATTCGGTTCCAC
GTCAGAAAGTGACACGTCAACTTTCCACGGCTTTGATGAGGACGATTTGGAAGAGCCTCGCTCCTGTCGA
GGACGCCGCAGTGGCCGGGGTTCGCCCACAGCAGATAAAAAGGGCAGTTGCTAA


Restriction Sites SgfI-MluI     
ACCN NM_001280543
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001280543.1, NP_001267472.1
RefSeq Size 4221 bp
RefSeq ORF 1104 bp
Locus ID 8110
UniProt ID Q92784
Protein Families Transcription Factors
Gene Summary This gene encodes a member of the D4 protein family. The encoded protein is a transcription regulator that binds acetylated histones and is a component of the BAF chromatin remodeling complex. Alternate splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (3) has a distinct N-terminus and is longer than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...