Human ADAR1 (ADAR) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	ADAR
Locus ID	103
Kit Components	GA100067G1, ADAR1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACGGGCCATTCAAAGACTAC GA100067G2, ADAR1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTGGTTCTTCCTCCCACGCC GA100067G3, ADAR1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCGCTGTTTTGGGTACAGTG 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_001025107, NM_001111, NM_001193495, NM_015840, NM_015841, NM_001365046, NM_001365048, NM_001365049, NM_001365045, NM_001365047
Synonyms	ADAR1; AGS6; DRADA; DSH; DSRAD; G1P1; IFI-4; IFI4; K88DSRBP; P136
Summary	This gene encodes the enzyme responsible for RNA editing by site-specific deamination of adenosines. This enzyme destabilizes double-stranded RNA through conversion of adenosine to inosine. Mutations in this gene have been associated with dyschromatosis symmetrica hereditaria. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2010]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.