Human RED1 (ADARB1) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	ADARB1
Locus ID	104
Kit Components	GA100068G1, RED1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCGTGTCTGTCGTGGGCAGC GA100068G2, RED1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGAGTCTCCTCAGCCGCGCT GA100068G3, RED1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TGAGGGAGGTGCCACAGCTC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_001033049, NM_001112, NM_001145407, NM_001160230, NM_015833, NM_015834, NR_027672, NR_027673, NR_027674, NR_073200, NM_001346687, NM_001346688, NR_144483
Synonyms	ADAR2; ADAR2a; ADAR2a-L1; ADAR2a-L2; ADAR2a-L3; ADAR2b; ADAR2c; ADAR2d; ADAR2g; DRABA2; DRADA2
Summary	This gene encodes the enzyme responsible for pre-mRNA editing of the glutamate receptor subunit B by site-specific deamination of adenosines. Studies in rat found that this enzyme acted on its own pre-mRNA molecules to convert an AA dinucleotide to an AI dinucleotide which resulted in a new splice site. Alternative splicing of this gene results in several transcript variants, some of which have been characterized by the presence or absence of an ALU cassette insert and a short or long C-terminal region. [provided by RefSeq, Jul 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.