Human CD5 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	CD5
Locus ID	921
Kit Components	GA100648G1, CD5 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AAACCGGGGAGTGTCTAAGT GA100648G2, CD5 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAGTGTCTAAGTGGGTCTAA GA100648G3, CD5 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAAATCGGGCATAAGACAAT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_014207, NM_001346456
Synonyms	LEU1; T1
Summary	This gene encodes a member of the scavenger receptor cysteine-rich (SRCR) superfamily. Members of this family are secreted or membrane-anchored proteins mainly found in cells associated with the immune system. This protein is a type-I transmembrane glycoprotein found on the surface of thymocytes, T lymphocytes and a subset of B lymphocytes. The encoded protein contains three SRCR domains and may act as a receptor to regulate T-cell proliferation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2016]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.