Human CD5 activation kit by CRISPRa
CAT#: GA100648
CD5 CRISPRa kit - CRISPR gene activation of human CD5 molecule
CNY 12,255.00
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
Symbol | CD5 |
Locus ID | 921 |
Kit Components | GA100648G1, CD5 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AAACCGGGGAGTGTCTAAGT GA100648G2, CD5 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAGTGTCTAAGTGGGTCTAA GA100648G3, CD5 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAAATCGGGCATAAGACAAT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc. |
Reference Data | |
RefSeq | NM_014207, NM_001346456 |
Synonyms | LEU1; T1 |
Summary | This gene encodes a member of the scavenger receptor cysteine-rich (SRCR) superfamily. Members of this family are secreted or membrane-anchored proteins mainly found in cells associated with the immune system. This protein is a type-I transmembrane glycoprotein found on the surface of thymocytes, T lymphocytes and a subset of B lymphocytes. The encoded protein contains three SRCR domains and may act as a receptor to regulate T-cell proliferation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2016] |
Documents
Resources
基因表达相关资源 |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN206494 | CD5 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12,260.00 |
|
KN206494BN | CD5 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12,260.00 |
|
KN206494LP | CD5 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12,260.00 |
|
KN206494RB | CD5 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12,260.00 |
|
KN406494 | CD5 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8,680.00 |