Human CD20 (MS4A1) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	MS4A1
Locus ID	931
Kit Components	GA100658G1, CD20 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: ATCAGTAGCTTCTGCTACCT GA100658G2, CD20 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTTTGCACCTCCTTCAGCTA GA100658G3, CD20 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCAGCCCCCACCCTATAAGC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_021950, NM_152866, NM_152867
Synonyms	B1; Bp35; CD20; CVID5; LEU-16; MS4A2; S7
Summary	This gene encodes a member of the membrane-spanning 4A gene family. Members of this nascent protein family are characterized by common structural features and similar intron/exon splice boundaries and display unique expression patterns among hematopoietic cells and nonlymphoid tissues. This gene encodes a B-lymphocyte surface molecule which plays a role in the development and differentiation of B-cells into plasma cells. This family member is localized to 11q12, among a cluster of family members. Alternative splicing of this gene results in two transcript variants which encode the same protein. [provided by RefSeq, Jul 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.