Human B7-1 (CD80) activation kit by CRISPRa
CAT#: GA100663
CD80 CRISPRa kit - CRISPR gene activation of human CD80 molecule
CNY 12,255.00
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
Symbol | CD80 |
Locus ID | 941 |
Kit Components | GA100663G1, B7-1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAAACACCACGAGCACCAGG GA100663G2, B7-1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTTTGTTAGTCCATGCACGG GA100663G3, B7-1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TAGTCCATGCACGGTGGTGA 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc. |
Reference Data | |
RefSeq | NM_005191 |
Synonyms | B7; B7-1; B7.1; BB1; CD28LG; CD28LG1; LAB7 |
Summary | The protein encoded by this gene is a membrane receptor that is activated by the binding of CD28 or CTLA-4. The activated protein induces T-cell proliferation and cytokine production. This protein can act as a receptor for adenovirus subgroup B and may play a role in lupus neuropathy. [provided by RefSeq, Aug 2011] |
Documents
Resources
基因表达相关资源 |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN406540 | CD80 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8,680.00 |