Human Collagen IV (COL4A3) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	COL4A3
Locus ID	1285
Kit Components	GA100899G1, Collagen IV gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCCCTCCCTCCCAACTTACC GA100899G2, Collagen IV gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCAGGAGGCGAGAAAGGGCT GA100899G3, Collagen IV gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGGACACTGCCTGGTAAGTT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_000091, NM_031362, NM_031363, NM_031364, NM_031365, NM_031366
Synonyms	alpha 3 type IV collagen; alpha3 type IV collagen; collagen, type IV, alpha 3 (Goodpasture antigen); collagen IV, alpha-3 polypeptide; Goodpasture antigen; OTTHUMP00000195044; TUMSTATIN; tumstatin
Summary	Type IV collagen, the major structural component of basement membranes, is a multimeric protein composed of 3 alpha subunits. These subunits are encoded by 6 different genes, alpha 1 through alpha 6, each of which can form a triple helix structure with 2 other subunits to form type IV collagen. This gene encodes alpha 3. In the Goodpasture syndrome, autoantibodies bind to the collagen molecules in the basement membranes of alveoli and glomeruli. The epitopes that elicit these autoantibodies are localized largely to the non-collagenous C-terminal domain of the protein. A specific kinase phosphorylates amino acids in this same C-terminal region and the expression of this kinase is upregulated during pathogenesis. This gene is also linked to an autosomal recessive form of Alport syndrome. The mutations contributing to this syndrome are also located within the exons that encode this C-terminal region. Like the other members of the type IV collagen gene family, this gene is organized in a head-to-head conformation with another type IV collagen gene so that each gene pair shares a common promoter. [provided by RefSeq, Jun 2010]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.