Human eIF1A (EIF1AX) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	EIF1AX
Locus ID	1964
Kit Components	GA101361G1, eIF1A gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCGTCTCCCGGTTTCACAAG GA101361G2, eIF1A gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTCCCACAACGCGTCTCCCT GA101361G3, eIF1A gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTCTAACAATAGGAGTCAGT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_001412
Synonyms	eIF-1A; eIF-4C; EIF1A; EIF1AP1; EIF4C
Summary	This gene encodes an essential eukaryotic translation initiation factor. The protein is required for the binding of the 43S complex (a 40S subunit, eIF2/GTP/Met-tRNAi and eIF3) to the 5' end of capped RNA. [provided by RefSeq, Jul 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.