Human EZH2 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	EZH2
Locus ID	2146
Kit Components	GA101494G1, EZH2 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGCGGGCCCTGTGATTGGAC GA101494G2, EZH2 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGAGTGCGCTCAGGGCTCGT GA101494G3, EZH2 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTCGCTGTAAGGGACGCCAC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_001203247, NM_001203248, NM_001203249, NM_004456, NM_152998
Synonyms	ENX-1; ENX1; EZH1; EZH2b; KMT6; KMT6A; WVS; WVS2
Summary	This gene encodes a member of the Polycomb-group (PcG) family. PcG family members form multimeric protein complexes, which are involved in maintaining the transcriptional repressive state of genes over successive cell generations. This protein associates with the embryonic ectoderm development protein, the VAV1 oncoprotein, and the X-linked nuclear protein. This protein may play a role in the hematopoietic and central nervous systems. Multiple alternatively splcied transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Feb 2011]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.