Human Factor VIII (F8) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	F8
Locus ID	2157
Kit Components	GA101502G1, Factor VIII gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGTTGGAGTAGGCTAGGAAT GA101502G2, Factor VIII gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TATCAGTGGGAAGCAGCCAC GA101502G3, Factor VIII gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCTGCTTCCCACTGATAAAA 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_000132, NM_019863
Synonyms	AHF; DXS1253E; F8B; F8C; FVIII; HEMA
Summary	This gene encodes coagulation factor VIII, which participates in the intrinsic pathway of blood coagulation; factor VIII is a cofactor for factor IXa which, in the presence of Ca+2 and phospholipids, converts factor X to the activated form Xa. This gene produces two alternatively spliced transcripts. Transcript variant 1 encodes a large glycoprotein, isoform a, which circulates in plasma and associates with von Willebrand factor in a noncovalent complex. This protein undergoes multiple cleavage events. Transcript variant 2 encodes a putative small protein, isoform b, which consists primarily of the phospholipid binding domain of factor VIIIc. This binding domain is essential for coagulant activity. Defects in this gene results in hemophilia A, a common recessive X-linked coagulation disorder. [provided by RefSeq, Jul 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.