Human hemoglobin subunit gamma 1 (HBG1) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	HBG1
Locus ID	3047
Kit Components	GA102075G1, hemoglobin subunit gamma 1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TATCTGTCTGAAACGGTCCC GA102075G2, hemoglobin subunit gamma 1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCTAAACTCCACCCATGGGT GA102075G3, hemoglobin subunit gamma 1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACTGGATACTCTAAGACTAT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_000559
Synonyms	HBG-T2; HBGA; HBGR; HSGGL1; PRO2979
Summary	The gamma globin genes (HBG1 and HBG2) are normally expressed in the fetal liver, spleen and bone marrow. Two gamma chains together with two alpha chains constitute fetal hemoglobin (HbF) which is normally replaced by adult hemoglobin (HbA) at birth. In some beta-thalassemias and related conditions, gamma chain production continues into adulthood. The two types of gamma chains differ at residue 136 where glycine is found in the G-gamma product (HBG2) and alanine is found in the A-gamma product (HBG1). The former is predominant at birth. The order of the genes in the beta-globin cluster is: 5'-epsilon -- gamma-G -- gamma-A -- delta -- beta--3'. [provided by RefSeq, Jul 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.