Human HNF 4 alpha (HNF4A) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	HNF4A
Locus ID	3172
Kit Components	GA102164G1, HNF 4 alpha gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCACTTAGGGAACCCGCGGC GA102164G2, HNF 4 alpha gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCTCCATGGCAATGGCGACC GA102164G3, HNF 4 alpha gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACCCGAGTGGACCTCAGGTC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_000457, NM_001030003, NM_001030004, NM_001258355, NM_001287182, NM_001287183, NM_001287184, NM_175914, NM_178849, NM_178850
Synonyms	FRTS4; HNF4; HNF4a7; HNF4a8; HNF4a9; HNF4alpha; MODY; MODY1; NR2A1; NR2A21; TCF; TCF14
Summary	The protein encoded by this gene is a nuclear transcription factor which binds DNA as a homodimer. The encoded protein controls the expression of several genes, including hepatocyte nuclear factor 1 alpha, a transcription factor which regulates the expression of several hepatic genes. This gene may play a role in development of the liver, kidney, and intestines. Mutations in this gene have been associated with monogenic autosomal dominant non-insulin-dependent diabetes mellitus type I. Alternative splicing of this gene results in multiple transcript variants encoding several different isoforms. [provided by RefSeq, Apr 2012]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.