Human Tenascin C (TNC) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	TNC
Locus ID	3371
Kit Components	GA102293G1, Tenascin C gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: ATTTCACTAACAGCTACTCG GA102293G2, Tenascin C gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: ATGAAAGACGCACTCACTCC GA102293G3, Tenascin C gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTATATAAGCCAGCCAAAGT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_002160
Synonyms	150-225; DFNA56; GMEM; GP; HXB; JI; TN; TN-C
Summary	This gene encodes an extracellular matrix protein with a spatially and temporally restricted tissue distribution. This protein is homohexameric with disulfide-linked subunits, and contains multiple EGF-like and fibronectin type-III domains. It is implicated in guidance of migrating neurons as well as axons during development, synaptic plasticity, and neuronal regeneration. [provided by RefSeq, Jul 2011]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.