Human IL12B activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	IL12B
Locus ID	3593
Kit Components	GA102402G1, IL12B gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTTCCTTCTTCCTCGATCTG GA102402G2, IL12B gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTGGGGAATAAGGAAGGAGA GA102402G3, IL12B gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGGTGCTTGGAGACAGCACT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_002187
Synonyms	CLMF; CLMF2; IL-12B; IMD28; IMD29; NKSF; NKSF2
Summary	This gene encodes a subunit of interleukin 12, a cytokine that acts on T and natural killer cells, and has a broad array of biological activities. Interleukin 12 is a disulfide-linked heterodimer composed of the 40 kD cytokine receptor like subunit encoded by this gene, and a 35 kD subunit encoded by IL12A. This cytokine is expressed by activated macrophages that serve as an essential inducer of Th1 cells development. This cytokine has been found to be important for sustaining a sufficient number of memory/effector Th1 cells to mediate long-term protection to an intracellular pathogen. Overexpression of this gene was observed in the central nervous system of patients with multiple sclerosis (MS), suggesting a role of this cytokine in the pathogenesis of the disease. The promoter polymorphism of this gene has been reported to be associated with the severity of atopic and non-atopic asthma in children. [provided by RefSeq, Jul 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.