Human Insulin (INS) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	INS
Locus ID	3630
Kit Components	GA102433G1, Insulin gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCAGCACCAGGGAAATGGTC GA102433G2, Insulin gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGGTTGAGAGGTAGGGGAGA GA102433G3, Insulin gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTCGTCAGCACCTCTTCCTC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_000207, NM_001185097, NM_001185098, NM_001291897
Synonyms	IDDM; IDDM1; IDDM2; ILPR; IRDN; MODY10
Summary	This gene encodes insulin, a peptide hormone that plays a vital role in the regulation of carbohydrate and lipid metabolism. After removal of the precursor signal peptide, proinsulin is post-translationally cleaved into three peptides: the B chain and A chain peptides, which are covalently linked via two disulfide bonds to form insulin, and C-peptide. Binding of insulin to the insulin receptor (INSR) stimulates glucose uptake. A multitude of mutant alleles with phenotypic effects have been identified, including insulin-dependent diabetes mellitus, permanent neonatal diabetes diabetes mellitus, maturity-onset diabetes of the young type 10 and hyperproinsulinemia. There is a read-through gene, INS-IGF2, which overlaps with this gene at the 5' region and with the IGF2 gene at the 3' region. [provided by RefSeq, May 2020]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.