Human PDX1 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	PDX1
Locus ID	3651
Kit Components	GA102446G1, PDX1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCTGGCCGCACTAAGAGGCT GA102446G2, PDX1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTTCAGGAGTGTGCAGCAAA GA102446G3, PDX1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAACAAAAGCAGGTGCTCGC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_000209, NM_013311
Synonyms	GSF; IDX-1; IPF1; IUF1; MODY4; PAGEN1; PDX-1; STF-1
Summary	The protein encoded by this gene is a transcriptional activator of several genes, including insulin, somatostatin, glucokinase, islet amyloid polypeptide, and glucose transporter type 2. The encoded nuclear protein is involved in the early development of the pancreas and plays a major role in glucose-dependent regulation of insulin gene expression. Defects in this gene are a cause of pancreatic agenesis, which can lead to early-onset insulin-dependent diabetes mellitus (IDDM), as well as maturity onset diabetes of the young type 4 (MODY4). [provided by RefSeq, Aug 2017]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.