Human Leptin (LEP) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	LEP
Locus ID	3952
Kit Components	GA102677G1, Leptin gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGGAGCCACGCGCGCACCCT GA102677G2, Leptin gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CATAGTCGCGCCGGAGCCTC GA102677G3, Leptin gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CACGTCGCTACCCTGAGGGG 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_000230
Synonyms	LEPD; OB; OBS
Summary	This gene encodes a protein that is secreted by white adipocytes into the circulation and plays a major role in the regulation of energy homeostasis. Circulating leptin binds to the leptin receptor in the brain, which activates downstream signaling pathways that inhibit feeding and promote energy expenditure. This protein also has several endocrine functions, and is involved in the regulation of immune and inflammatory responses, hematopoiesis, angiogenesis, reproduction, bone formation and wound healing. Mutations in this gene and its regulatory regions cause severe obesity and morbid obesity with hypogonadism in human patients. A mutation in this gene has also been linked to type 2 diabetes mellitus development. [provided by RefSeq, Aug 2017]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.