Human Mucin 5AC (MUC5AC) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	MUC5AC
Locus ID	4586
Kit Components	GA103036G1, Mucin 5AC gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCCAGCCCCGTGCTTCACGT GA103036G2, Mucin 5AC gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCCCTCACCCAAGTAAACAG GA103036G3, Mucin 5AC gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTTGGGTGAGGGGGAACCAC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_001304359, NM_017511
Synonyms	leB; MUC5; mucin; TBM
Summary	Gel-forming glycoprotein of gastric and respiratoy tract epithelia that protects the mucosa from infection and chemical damage by binding to inhaled microrganisms and particles that are subsequently removed by the mucocilary system.[UniProtKB/Swiss-Prot Function]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.