Human OTX2 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	OTX2
Locus ID	5015
Kit Components	GA103345G1, OTX2 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TACAATTAGTTCACATGCTC GA103345G2, OTX2 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GATTGACACATCTAAGCCAG GA103345G3, OTX2 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCGTCAAAAAGTTGCCAGAG 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_001270523, NM_001270524, NM_001270525, NM_021728, NM_172337, NR_073034, NR_073036
Synonyms	CPHD6; MCOPS5
Summary	This gene encodes a member of the bicoid subfamily of homeodomain-containing transcription factors. The encoded protein acts as a transcription factor and plays a role in brain, craniofacial, and sensory organ development. The encoded protein also influences the proliferation and differentiation of dopaminergic neuronal progenitor cells during mitosis. Mutations in this gene cause syndromic microphthalmia 5 (MCOPS5) and combined pituitary hormone deficiency 6 (CPHD6). This gene is also suspected of having an oncogenic role in medulloblastoma. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Pseudogenes of this gene are known to exist on chromosomes two and nine. [provided by RefSeq, Jul 2012]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.