Human Perilipin-1 (PLIN1) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	PLIN1
Locus ID	5346
Kit Components	GA103605G1, Perilipin-1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AATACTAAGTCCTCTGAGCC GA103605G2, Perilipin-1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGTCATATAACCATGACAAC GA103605G3, Perilipin-1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAAACAATTCCTGTCACTCC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_001145311, NM_002666
Synonyms	FPLD4; PERI; PLIN
Summary	The protein encoded by this gene coats lipid storage droplets in adipocytes, thereby protecting them until they can be broken down by hormone-sensitive lipase. The encoded protein is the major cAMP-dependent protein kinase substrate in adipocytes and, when unphosphorylated, may play a role in the inhibition of lipolysis. Alternatively spliced transcript variants varying in the 5' UTR, but encoding the same protein, have been found for this gene. [provided by RefSeq, Feb 2009]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.