Human Kallikrein 6 (KLK6) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	KLK6
Locus ID	5653
Kit Components	GA103832G1, Kallikrein 6 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCAAAGGAGGACTGTCAGAC GA103832G2, Kallikrein 6 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGCCTCAACCTCTCTTCCGG GA103832G3, Kallikrein 6 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GACAAAGCCCGATTGTTCCT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_001012964, NM_001012965, NM_001012966, NM_001319948, NM_001319949, NM_002774
Synonyms	Bssp; hK6; Klk7; PRSS9; PRSS18; SP59
Summary	This gene encodes a member of the kallikrein subfamily of the peptidase S1 family of serine proteases. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. The encoded preproprotein is proteolytically processed to generate the mature protease. Expression of this protease is regulated by steroid hormones and may be elevated in multiple human cancers and in serum from psoriasis patients. The encoded protease may participate in the cleavage of amyloid precursor protein and alpha-synuclein, thus implicating this protease in Alzheimer's and Parkinson's disease, respectively. This gene is located in a gene cluster on chromosome 19. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Feb 2016]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.