Human Thyroid Peroxidase (TPO) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	TPO
Locus ID	7173
Kit Components	GA104957G1, Thyroid Peroxidase gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAGTGGCGTCCGTTCTTCGT GA104957G2, Thyroid Peroxidase gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCCACATGCAGTCCAGCCTC GA104957G3, Thyroid Peroxidase gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCATGTGGACCCCGATGACA 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_000547, NM_001206744, NM_001206745, NM_175719, NM_175720, NM_175721, NM_175722
Synonyms	MSA; TDH2A; TPX
Summary	This gene encodes a membrane-bound glycoprotein. The encoded protein acts as an enzyme and plays a central role in thyroid gland function. The protein functions in the iodination of tyrosine residues in thyroglobulin and phenoxy-ester formation between pairs of iodinated tyrosines to generate the thyroid hormones, thyroxine and triiodothyronine. Mutations in this gene are associated with several disorders of thyroid hormonogenesis, including congenital hypothyroidism, congenital goiter, and thyroid hormone organification defect IIA. Multiple transcript variants encoding distinct isoforms have been identified for this gene, but the full-length nature of some variants has not been determined. [provided by RefSeq, May 2011]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.