Human MALL activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	MALL
Locus ID	7851
Kit Components	GA105336G1, MALL gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CAAGATGGTGGACATGGCTG GA105336G2, MALL gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCCACATCCTAGAGAGGGAC GA105336G3, MALL gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGGGCAGGGAGACAAACAAT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_005434
Synonyms	BENE
Summary	This gene encodes an element of the machinery for raft-mediated trafficking in endothelial cells. The encoded protein, a member of the MAL proteolipid family, predominantly localizes in glycolipid- and cholesterol-enriched membrane (GEM) rafts. It interacts with caveolin-1. [provided by RefSeq, Jul 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.