Human Apolipoprotein L 1 (APOL1) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	APOL1
Locus ID	8542
Kit Components	GA105656G1, Apolipoprotein L 1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GACCTGCCACTGACATACTA GA105656G2, Apolipoprotein L 1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAATTCCTCGGTATATCTTG GA105656G3, Apolipoprotein L 1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCAGTCCCCAAGATATACCG 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_001136540, NM_001136541, NM_003661, NM_145343, NM_145344, NM_001362927
Synonyms	APO-L; APOL; APOL-I; FSGS4
Summary	This gene encodes a secreted high density lipoprotein which binds to apolipoprotein A-I. Apolipoprotein A-I is a relatively abundant plasma protein and is the major apoprotein of HDL. It is involved in the formation of most cholesteryl esters in plasma and also promotes efflux of cholesterol from cells. This apolipoprotein L family member may play a role in lipid exchange and transport throughout the body, as well as in reverse cholesterol transport from peripheral cells to the liver. Several different transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.