Human TNFSF9 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	TNFSF9
Locus ID	8744
Kit Components	GA105808G1, TNFSF9 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCTGCGGAATTTTCTCCACT GA105808G2, TNFSF9 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAAAATTCCGCAGAGTCACG GA105808G3, TNFSF9 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGCTGCTTGGCTACAAAAGG 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_003811
Synonyms	4-1BB-L; CD137L; TNLG5A
Summary	The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This transmembrane cytokine is a bidirectional signal transducer that acts as a ligand for TNFRSF9/4-1BB, which is a costimulatory receptor molecule in T lymphocytes. This cytokine and its receptor are involved in the antigen presentation process and in the generation of cytotoxic T cells. The receptor TNFRSF9/4-1BB is absent from resting T lymphocytes but rapidly expressed upon antigenic stimulation. The ligand encoded by this gene, TNFSF9/4-1BBL, has been shown to reactivate anergic T lymphocytes in addition to promoting T lymphocyte proliferation. This cytokine has also been shown to be required for the optimal CD8 responses in CD8 T cells. This cytokine is expressed in carcinoma cell lines, and is thought to be involved in T cell-tumor cell interaction.[provided by RefSeq, Oct 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.