Human DDX18 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	DDX18
Locus ID	8886
Kit Components	GA105918G1, DDX18 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTGGAAGCGAGACGCTGCAC GA105918G2, DDX18 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTTGGTCGCCAAAGATATCA GA105918G3, DDX18 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTCACAGGAACGCTGGCACC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_006773
Synonyms	MrDb
Summary	DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, and it is activated by Myc protein. [provided by RefSeq, Jul 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.