Human DRAK2 (STK17B) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	STK17B
Locus ID	9262
Kit Components	GA106178G1, DRAK2 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCTTGTAGGAACAGAACCAA GA106178G2, DRAK2 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCCTAACAAGAATAAACCCT GA106178G3, DRAK2 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTGGTTAAGTGTGTGACATC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_004226
Synonyms	DRAK2
Summary	Phosphorylates myosin light chains (By similarity). Acts as a positive regulator of apoptosis.[UniProtKB/Swiss-Prot Function]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.