Human DRAK1 (STK17A) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	STK17A
Locus ID	9263
Kit Components	GA106179G1, DRAK1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTGACTCTCAGACGCTCAAC GA106179G2, DRAK1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCTAACGCAGTAGGCTGTCC GA106179G3, DRAK1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CGACTCACAGCACCACCCTT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_004760
Synonyms	DRAK1
Summary	This gene is a member of the DAP kinase-related apoptosis-inducing protein kinase family and encodes an autophosphorylated nuclear protein with a protein kinase domain. The protein has apoptosis-inducing activity. [provided by RefSeq, Jul 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.