Human WWP1 activation kit by CRISPRa

CAT#: GA107598

WWP1 CRISPRa kit - CRISPR gene activation of human WW domain containing E3 ubiquitin protein ligase 1



  See Other Versions

CNY 12,255.00


货期*
4周

规格
    • 1 kit

Product images

经常一起买 (3)
WWP1 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


WWP1 (Myc-DDK-tagged)-Human WW domain containing E3 ubiquitin protein ligase 1 (WWP1)
    • 10 ug

CNY 10,128.00


WWP1 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol WWP1
Locus ID 11059
Kit Components

GA107598G1, WWP1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AAGTCTTCGGGTATGACCAA

GA107598G2, WWP1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GACCTTAAGAAGTCCTGCTC

GA107598G3, WWP1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACGGACAGCCAATAGTAGGG

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077

Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq NM_007013
Synonyms AIP5; hSDRP1; Tiul1
Summary WW domain-containing proteins are found in all eukaryotes and play an important role in the regulation of a wide variety of cellular functions such as protein degradation, transcription, and RNA splicing. This gene encodes a protein which contains 4 tandem WW domains and a HECT (homologous to the E6-associated protein carboxyl terminus) domain. The encoded protein belongs to a family of NEDD4-like proteins, which are E3 ubiquitin-ligase molecules and regulate key trafficking decisions, including targeting of proteins to proteosomes or lysosomes. Alternative splicing of this gene generates at least 6 transcript variants; however, the full length nature of these transcripts has not been defined. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Other Versions

Customer Reviews 
Loading...