Human WWP1 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	WWP1
Locus ID	11059
Kit Components	GA107598G1, WWP1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AAGTCTTCGGGTATGACCAA GA107598G2, WWP1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GACCTTAAGAAGTCCTGCTC GA107598G3, WWP1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACGGACAGCCAATAGTAGGG 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_007013
Synonyms	AIP5; hSDRP1; Tiul1
Summary	WW domain-containing proteins are found in all eukaryotes and play an important role in the regulation of a wide variety of cellular functions such as protein degradation, transcription, and RNA splicing. This gene encodes a protein which contains 4 tandem WW domains and a HECT (homologous to the E6-associated protein carboxyl terminus) domain. The encoded protein belongs to a family of NEDD4-like proteins, which are E3 ubiquitin-ligase molecules and regulate key trafficking decisions, including targeting of proteins to proteosomes or lysosomes. Alternative splicing of this gene generates at least 6 transcript variants; however, the full length nature of these transcripts has not been defined. [provided by RefSeq, Jul 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.