Human SETBP1 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	SETBP1
Locus ID	26040
Kit Components	GA108715G1, SETBP1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTTTTCTTCAAAGGATGGGT GA108715G2, SETBP1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: AAGCATTGATCGGAGAGACG GA108715G3, SETBP1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CGAGCCCTGCTAATTTTAGC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_001130110, NM_015559
Synonyms	MRD29; SEB
Summary	This gene encodes a protein which contains a several motifs including a ski homology region and a SET-binding region in addition to three nuclear localization signals. The encoded protein has been shown to bind the SET nuclear oncogene which is involved in DNA replication. Mutations in this gene are associated with Schinzel-Giedion midface retraction syndrome. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.