Human ST6GALNAC6 activation kit by CRISPRa

CAT#: GA109385

ST6GALNAC6 CRISPRa kit - CRISPR gene activation of human ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 6



  See Other Versions

CNY 12,255.00


货期*
4周

规格
    • 1 kit

Product images

经常一起买 (3)
Rabbit Polyclonal Anti-ST6GALNAC6 Antibody
    • 100 ul

CNY 5,250.00


ST6GALNAC6 (Myc-DDK-tagged)-Human ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 6 (ST6GALNAC6)
    • 10 ug

CNY 2,400.00
CNY 5,320.00


Rabbit Polyclonal Anti-ST6GALNAC6 Antibody
    • 100 ul

CNY 5,250.00

Specifications

Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol ST6GALNAC6
Locus ID 30815
Kit Components

GA109385G1, ST6GALNAC6 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCCAGCTACTCAGTAGGCTG

GA109385G2, ST6GALNAC6 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGAGTCTCACTCTGTCGCCC

GA109385G3, ST6GALNAC6 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCTCGGCCTCCCAAAGTGCT

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077

Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq NM_001286999, NM_001287000, NM_001287001, NM_001287002, NM_001287003, NM_013443, NR_104629
Synonyms SIAT7-F; SIAT7F; ST6GALNACVI
Summary ST6GALNAC6 belongs to a family of sialyltransferases that modify proteins and ceramides on the cell surface to alter cell-cell or cell-extracellular matrix interactions (Tsuchida et al., 2003 [PubMed 12668675]).[supplied by OMIM, Mar 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Other Versions

Customer Reviews 
Loading...